Hloroquine (one hundred) [75] or heparin (25 /mL) [76] were used as optimistic controls of viral inhibition. four.5. Quantification of Antiviral Activity by Plaque Assay The viral titer of antiviral assay supernatants was determined by plaque assay. Briefly, 1.2 105 Vero E6 cells/well have been seeded in 24-well plates for 24 h, at 37 C, with five CO2 . Subsequently, 10-fold serial dilutions with the supernatant obtained from all antiviral assays (200 /well) were added to cell monolayers and incubated for 1 h at 37 C with 5 CO2 . Then, the viral inoculum was removed and replaced with 1 mL of semi-solid medium (1.5 carboxymethyl-cellulose in DMEM 1with 2 FBS and 1 Penicillin treptomycin). The cells were incubated for 3 d at 37 C and then washed twice with PBS and fixed-stained with 4 Formaldehyde/1 crystal violet resolution; then, the viral plaques were counted. The difference among viral titer following curcumin treatment and untreated control was expressed as an inhibition percentage. Two independent experiments with two replicates each and every were carried out (n = four). 4.6. Evaluation of Anti-Inflammatory Activity in PBMCs Stimulated with SARS-CoV-2 Around 20 mL of total peripheral blood from every healthy adult donor (n = 3) was obtained by venipuncture in vacutainer tubes. PBMCs had been isolated utilizing the FicollHistopaque density gradient technique (Sigma-Aldrich Chemical Co., St. Louis, MO, USA) as previously described [77]. To evaluate the anti-inflammatory effect of curcumin, the PBMCs were seeded in 24-well plates (1 106 cells/well) in RPMI1640 medium (Sigma-Aldrich) supplemented with five FBS. The cells have been stimulated with curcumin (five and ten /mL) for 1 h. Just after pre-treatment, the SARS-CoV-2 was added at a MOI of 0.1 and incubated for 24 h, at 37 C with five CO2 . 3 independent experiments with two replicates were performed (n = 6). The cells with out any treatment had been employed as adverse controls. four.7. RNA Extraction, cDNA Synthesis, and Real-Time PCR The mRNA quantification for IL-1, IL-6, IL-8, MCP-1, and TNF- was carried out in PBMCs by real-time polymerase chain reaction (real-time PCR) as previously described [78]. Briefly, for total RNA extraction, the Direct-zol RNA Miniprep kit was applied (Zymo Investigation, Orange, CA, USA). RNA concentration/purity have been determined by spectrophotometry at 26080 nm and cDNA was synthesized with 140 ng of RNA using the iScript cDNA Synthesis kit (BIO-RAD, Hercules, CA, USA), based on the manufacturer’s directions. Real-time PCR was performed working with Maxima SYBR Green qPCR master mix kit (Fermentas, Glen Burnie, MD, USA). The mRNA PGK (phosphoglycerate kinase) was applied as the housekeeping gene to normalize the RNA content (Table 2). The amplification protocols had been 40 cycles and standardized for every single gene. For real-time Psalmotoxin 1 Technical Information RT-PCR evaluation, the CFX Manager Version: 1.five.534.0511 software (Bio-Rad, Hercules, CA, USA) was utilized. Data are expressed as fold adjust, normalized against the constitutive gene as well as the untreated manage, employing the Ct strategy, as previously reported [79].Molecules 2021, 26,14 ofTable 2. Primers sequence.Gene IL-1 IL-6 IL-8 TNF-a PGK (Housekeeping gene) Sequence of Primers 5 -3 Fw: GGATATGGAGCAACAAGTGG Rv: ATGTACCAGTTGGGGAACTG Fw: GGGGTGGTTATTGCATC Rv: ATTCGGTACATCCTCGAC Fw: Bafilomycin A1 Apoptosis ACTGAGAGTGATTGAGAGTGGAC Rv: AACCCTCTGCACCCAGTTTTC Fw: GGCTCCAGGCGGTGCTTGTTC Rv: AGA-GGCGATGCGGCTGATG Fw: GTTGACCGAATCACCGACC Rv: CGACTCTCATAACGACCCGC Annealing Temperature 60 C 56 C 60 C 60 C 60 C4.8. ELISA Concentrations of IL-1, IL-6, and IL-.
